Document · PDF

Worst Fears Realized_ Pfizer mRNA Transcribes into DNA.pdf

Raad 23 juni 2022, gemeente SluisBij agendapunt: Bijlagen bij de motie geïnformeerde toestemming corona vaccins fractie FvD1.350 woorden

Open het PDF bij de gemeente ↗Naar de vergadering →

Tekst van het document

Uit het bestand gehaald, zonder opmaak, tabellen en afbeeldingen

6/14/22, 9:03 AM

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

Igor’s Newsletter

Worst Fears Realized: Pfizer mRNA Transcribes into DNA mRNA Vaccines Actually are "Gene Therapy", Study Shows Igor Chudov Feb 25

378

418

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

It was Not Supposed to Happen For over a year, our trusted “health experts and fact checkers” kept telling us the opposite:

✖ Our use of cookies We use necessary cookies to make our site work. We also set performance and functionality cookies that help us make improvements by measuring traffic on our site. For more detailed information about the cookies we use, please see our privacy policy.

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?s=r

1/6

6/14/22, 9:03 AM

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

Details Type your email…

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA. It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more). ✖ Our use of cookies We use necessary cookies to make our site work. We also set performance and functionality cookies that help us make improvements by measuring traffic on our site. For more detailed information about the cookies we use, please see our privacy policy.

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?s=r

2/6

6/14/22, 9:03 AM

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc. This process is called “transcription”. For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS. To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1. Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?s=r

3/6

6/14/22, 9:03 AM

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

The genetic code that they picked up is: CGAGGTGGCCAAGAATCTGAACGAGA GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT TCGACGAGGACGATTCTGAGCCCGTGCTGA AGGGCGTGAAACTGCACTACACATGATGAC TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Anyone wants to run BLAST on it?

Simplified As I explained in response to a questioner: Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious "edit" from Pfizer. Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer. Type your email…

Cancer Code

✖ Our use of cookies

We use necessary cookies to make our site work. We also set performance and functionality cookies that help us make improvements by measuring traffic on our site. For more detailed information about the cookies we use, please see our privacy policy.

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?s=r

4/6

6/14/22, 9:03 AM

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA. Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.

Igor’s Newsletter

Moderna Patented CANCER GENE is in Sars-Cov-2 "Spike Protein" I did a little bit more digging into the topic of my article about genes from 2018 Moderna patent. I wrote about it yesterday, but kept reading and digging and found much more disturbing stuff than I expected. First, a recap: Sars-Cov2 virus has a genetic insert that exists ONLY in Moderna… Read more 4 months ago · 189 likes · 256 comments · Igor Chudov

Please repost this article far and wide due to its big implication for our public health. EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?

Thank you for reading Igor’s Newsletter. This post is public so feel free to share it.

✖ Our use of cookies

Subscribe to Igor’s Newsletter

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?s=r

5/6

6/14/22, 9:03 AM

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

Independent thoughts

Type your email…

378 likes

Comment

Write a comment… WG Feb 25

Liked by Igor Chudov

Good thing they skipped the 10 year vaccine development cycle. Warp speed baby! What a train wreck :( 155 Reply Collapse

30 replies by Igor Chudov and others

Joseph Vincetti Feb 25

Liked by Igor Chudov

Much of this I was already aware of but it's always nice to have actual scientific confirmation. It's amazing how virtually all of the so-called conspiracy theories keep being proven entirely true. From a more selfish perspective, I sincerely hope that those of us who remain unvaccinated yet were infected with Covid are not vulnerable to the Cancer causing proteins coded into the Covid virus since our DNA was never altered. I really appreciate you taking the time to do these deep dives and summarizing the important findings for us. 100 Reply Collapse

106 replies by Igor Chudov and others

416 more comments…

Ready for more? Type your email…

Get the app

Substack is the home for great writing

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?s=r

6/6

De tekst is automatisch uit het bestand gehaald en kan afwijken van het origineel (kolommen, tabellen en koppen lopen door elkaar). Het officiële stuk bij de gemeente is leidend. Bron: https://api1.ibabs.eu/publicdownload.aspx?site=Sluis&id=3b6554cf-9a4f-4980-9f86-b86589f516d0